According to the sequence below (note that the DNA is written in the 5' $\rightarrow$ 3' direction, and the gene of interest is underlined), the BEST forward primer to use for this gene is: $\rightarrow$ 3' direction, and the gene of interest is underlined), the BEST forward primer to use for this gene is: A) 5' GGTTTGAATCAAATGGCTGA 3'. B) 5'ATGACTGATACATCATCCTC 3'. C) 3' ATGACTGATACATCATCCTC 5'. D) 5' GAGGATGATGTATCAGTCAT 3'. E) 3' GAGGATGATGTATCAGTCAT 5'." class="answers-bank-image d-block" loading="lazy" >