How Many Amino Acids are Encoded by the Following MRNA

Question

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′
A) 8
B) 9
C) 10
D) 11

Accepted Answer

The mRNA sequence starts with a start codon (AUG) and ends with a stop codon (UGA). The sequence between these codons encodes for 8 amino acids.