Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?
(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG
(2) AAATGTTGGGATTCCGGAAGTAGTGAGTG
(3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG
(4) AAATGATGGGCTTCCGGGAGCGAGTGCCC